ماکی دام

دام، طیور، آبزیان

کد خبر: 2645
بازدید: 247
تاریخ انتشار: ۱۳۹۷/۹/۲۲ ساعت: 9:58:34 AM

تعیین جنسیت قناری با استفاده از نشانگر‌های ژنتیکی

تعیین جنسیت اغلب پرندگان ازجمله قناری، تا زمان بلوغ و حتی گاهی بعد از بلوغ امری نسبتاً مشکل است. امروزه با پیشرفت روش‌های مولکولی، تعیین جنسیت جانداران در هر مرحله از زندگی میسر می‌باشد.

تعیین جنسیت قناری با استفاده از نشانگر‌های ژنتیکی

به گزارش «سرویس دام، طیور و آبزیان» «ماکی دام - پایگاه خبری صنعت دام، طیور و آبزیان»؛ تعیین جنسیت اغلب پرندگان تا زمان بلوغ و حتی گاهی بعد از بلوغ امری نسبتاً مشکل است. اما جنسیت پرندگان و سایر جانوران از بدو تشکیل نطفه، به لحاظ ژنتیکی معین است. امروزه با پیشرفت روش‌های مولکولی، تعیین جنسیت جانداران در هر مرحله از زندگی میسر می‌باشد.

در تحقیق حاظر تعیین جنسیت در قناری با استفاده از واکنش PCR و براساس دو ژن CHD-W و CHD-Z شرح داده شده است. در این تحقیق جمعاً از 29 قطعه قناری استفاده شد. استخراج DNA از انتهای کالاموس پر قناری‌های زنده صورت پذیرفت و با استفاده از پرایمرهای اختصاصی طراحی شده در این طرح، واکنش PCR تنظیم گردید. نتایج نشان‌دهنده تکثیر دو قطعه DNA به طول‌های 345 و 306 جفت باز برای جنس ماده و فقط یک باند 306 جفت باز برای جنس نر بود. این نتایج برای کلیه نمونه‌های پر مشاهده شد. از آنجا که طراحی این سیستم تعیین جنسیت برای اولین بار در قناری مورد استفاده قرار می‌گیرد و نتایج مولکولی با ویژگی‌های مورفولوژیک دو جنس نر و ماده کاملاً مطابقت دارد، لذا تعیین جنسیت جوجه‌های قناری با انجام واکنش PCR روی نمونه‌های پر، آسان، سریع، بی‌خطر و ارزان می‌باشد.

مقدمه

قناری‌ها (Serinus canaria canaria) از جمله زیباترین پرندگان خانگی هستند که از زمان‌های بسیار دور نگهداری آنها به خاطر آواز دلنشین و رنگ‌آمیزی زیبایشان رایج شده و مورد توجه مردم سراسر دنیا قرار گرفته است. طبق دسته‌بندی سیستماتیک زیست‌شناسی، قناری وحشی به راسته گنجشک‌ها (Passeriformes) و به خانواده فنچ‌ها (Fringillidae) تعلق دارند. باتوجه به اینکه قناری‌ها از زمان بلوغ شروع به آواز خواندن می‌کنند و صدای زیبای قناری‌ها بیشتر توسط جنس نر تولید می‌شود، به همین دلیل جنس نر این پرنده نسبت به جنس ماده از لحاظ اقتصادی دارای ارزش بیشتری است و با قیمت افزون‌تری نسبت به جنس ماده به فروش می‌رسد.

یکی از بهترین راه‌ها برای تمایز دادن پرندگان نر و ماده استفاده از روش‌های مولکولی بر اساس DNA است. یافتن یک نشانگر مولکولی مناسب برای تعیین جنسیت، کاری دشوار است. از آنجا که ژنوتیپ پرنده ماده ZW و ژنوتیپ پرنده نر ZZ می‌باشد، لذا کروموزوم W فقط در جنس ماده پرندگان وجود دارد و بر اساس آن می‌توان مارکر ژنتیکی مناسبی برای تفکیک جنس‌های نر و ماده از هم یافت. این ویژگی همانند کروموزوم Y در انسان است با این تفاوت که در انسان و سایر پستانداران، جنس نر هتروگامتیک است و جنس ماده هموگامتیک می‌باشد ولی در پرندگان وضعیت دقیقا عکس است. برخی از ژن‌های موجود بر روی کروموزوم W بسیار حفظ شده بوده و با استفاده از این گونه ژن‌ها می‌توان در تمام گونه‌های پرندگان، جنسیت آنرا را با استفاده از یک جفت پرایمر و طی یک مرحله انجام واکنش PCR تعیین کرد. در برخی از پرندگان، نظیر پرندگان عظیم‌الجثه مانند شترمرغ، پرایمرهای مربوط به ژن CHD، سبب تکثیر قطعاتی در هر دو ژن CHD-W و CHD-Z می‌گردد زیرا این پرایمرها همزمان با هم قسمت‌های همولوگ از ژن CHD-W و ژن مرتبط آن یعنی CHD-Z را تکثیر می‌نمایند اما در این قطعات تکثیر شده، تفاوت طول مشاهده می‌گردد و از همین خاصیت می‌توان به منظور تعیین جنسیت پرندگان بهره گرفت.

هدف از این تحقیق تنظیم روش PCR برای تعیین جنسیت قناری برای اولین بار با پرایمرهای جدید طراحی شده می‌باشد.

مواد و روش‌ها

به منظور تعیین جنسیت قناری جمعاً از 29 قطعه قناری نمونه‌گیری به عمل آمد. نمونه‌گیری از انتهای کالاموس پر قناری‌های زنده (11 ماده و 6 نر و 12 جوجه قناری با جنسیت نامعلوم) صورت گرفت و DNAی ژنومی با استفاده از روش استاندارد فنل -کلروفرم استخراج گردید و جهت اطمینان از کیفیت DNA و مشاهده قطعات DNAی استخراج شده از ژل آگار 1درصد و رنگ‌آمیزی توسط اتیدیوم برماید استفاده شد، همچنین کیفیت DNA استخراج شده توسط دستگاه اسپکتروفوتومتر نیز بررسی گردید. به منظور انجام PCR، نیاز به پرایمرهای اختصاصی تعیین جنسیت می‌باشد که بر اساس ژن CHD قناری طراحی گردند. اما پس از انجام مطالعات بسیار، توالی ژن CHD قناری یافت نشد لذا به منظور طراحی پرایمر از توالی ژن CHD-W مربوط به پرنده ای با نام علمی frontalis Hemispingus که از خانواده Fringillidae می‌باشد و قرابت فیلوژنتیکی بالایی با Serinus canaria دارد، استفاده شد. توالی پرایمرهای طراحی شده برای این تحقیق به صورت زیر است:

Canary-F: 5'- GGATGAGGAACTGTGCAAAAC -3'

Canary-R: 5'- AATAGTTCGCGGTCTTCCAC -3'

برای انجام واکنش PCR حجم نهایی واکنش 25 میکرولیتر بوده که شامل: 20 نانوگرم DNA الگو، 2 میلی‌مولار MgCl2، 25 پیکومول از هر پرایمر، 1 واحد آنزیم DNA پلیمر از Taq و 200 میکرو مولار dNTP Mix بود. برای انجام واکنش PCR از دستگاه مسترسایکلر گرادینت شرکت Eppendorf استفاده شد. 

برنامه‌ی حرارتی مورد استفاده شامل: 95 درجه سانتی‌گراد 5 دقیقه، سپس 30 چرخه دمایی به ترتیب 94 درجه سانتی‌گراد 1 دقیقه، 58 درجه سانتی‌گراد 1 دقیقه و 72 درجه سانتی‌گراد 1 دقیقه و یک مرحله نهایی 72 درجه سانتی‌گراد 5 دقیقه تنظیم گردید. سپس محصولات PCR با ژل آگارز 1/5درصد الکتروفورز گردید و توسط اتیدیوم برماید رنگ‌آمیزی شد و با استفاده از نور UV مورد ارزیابی قرار گرفت.

بیشتر بدانیم:

تکنیک‌های تعیین جنسیت در پرندگان

تشخیص نر یا ماده قناری

آشنایی با تکثیر قناری‌ها

قناری نژاد استفورد (stafford canary)

نتایج و بحث

از کالاموس پر پرندگان مورد آزمایش، DNAی ژنومی با موفقیت استخراج گردید و کیفیت DNAی استخراج شده با استفاده از روش طیف سنجی و الکتروفورز روی ژل آگارز 1درصد تعیین گردید. سپس غلظت DNA استخراج شده به میزان 20 ng/μl تنظیم شد. انجام PCR با پرایمرهای اختصاصی طراحی شده‌ی تعیین جنسیت در قناری و مشاهده‌ی نتایج حاصل بر روی ژل آگارز 1/5 درصد نشان‌دهنده تکثیر دو قطعه DNA به طول‌های 345 و 306 جفت باز برای جنس ماده و یک باند 306 جفت باز برای جنس نر بود که در شکل 1 مشاهده می‌شود.

واکنش PCR برای تعیین جنسیت قناری

شکل 1 – واکنش PCR برای تعیین جنسیت قناری.

شماره‌های 1 تا 3 مربوط به قناری‌های ماده بوده که دو قطعه DNA به طول‌های 345 و 306 جفت باز تکثیر گردیده و شماره‌های 4 و 5 که فقط یک باند به طول 306 جفت باز دارند، نشان‌دهنده جنسیت نر در این پرنده می‌باشد.

شماره 6 مارکر 100 bp ساخت شرکت Fermentas می‌باشد.

.

نتایج حاصل نشان می‌دهد، تعیین جنسیت قناری با استفاده از این روش، بسیار سریع، دقیق و کم هزینه بوده و در هر دوره از زندگی این پرنده می‌تواند بکار رود. از آنجایی که تعیین جنسیت پرندگان با استفاده از روش‌های قدیمی مانند لمس کلواک، سنجش میزان استروئید، کاریوتایپینگ و... دشوار و زمان‌بر می‌باشد و حتی در برخی موارد موجب مرگ پرنده می‌شود لذا محققین متعددی تا کنون در راستای تعیین جنسیت مولکولی موجودات تلاش نموده اند و برخی نیز به نتایج مطلوبی دست یافته‌اند. برای مثال در سال 1998 Griffiths و همکاران با استفاده از دو ژن CHD-Z و CHD-Wو طراحی پرایمرهای متعدد، به تعیین جنسیت گروهی از پرندگان (شترمرغ، قو، کبوتر، غاز وحشی و...) پرداخته‌اند. در سال 2000، Nesje و همکاران سعی کردند با استفاده از دو جایگاه میکروستلایتی، پرندگانی از قبیل شاهین، باز وحشی، قوش و غیره را تعیین جنسیت نمایند اما این روش در تعیین جنسیت برخی از پرندگان مورد آزمایش موفقیت‌آمیز نبود. همچنین در سال 2004، Agate و همکاران برای تعیین جنسیت Zebra Finches از ژن CHD1-W و CHD1-Z استفاده کردند . در این تحقیق باتوجه به اینکه توالی ژن‌های CHD-Z و CHD-Wمربوط به قناری در بانک ژن جهانی ثبت نگردیده‌اند، لذا همان‌طور که در بالا اشاره شد، از روی توالی ژن CHD-W مربوط به پرنده‌ای شبیه به قناری، ترتیب نوکلئوتیدی پرایمرها انتخاب و نتایج مطلوبی در مورد تعیین جنسیت قناری بدست آمد. این سیستم تعیین جنسیت مولکولی بر اساسPCR که برای قناری ماده دو قطعه DNA و برای قناری نر، یک قطعه DNA تکثیر می‌نماید برای اولین بار تنظیم و معرفی می‌گردد.

گردآوری: عباس دوستی، سعادت مشکلانی

مرکز تحقیقات بیوتکنولوژی، دانشگاه آزاد اسلامی‌واحد شهرکرد

منبع: ژنتیک نوین


نام:
پست الکترونیک:
نظر:
*
نظر شما با موفقیت ارسال شد.
نظر شما حداکثر تا 24 ساعت آینده بررسی می شود
ارسال نظر
نظرات حاوی توهین و افترا منتشر نخواهد شد
نظرات به زبانهایی به غیر از زبان فارسی منتشر نخواهد شد
نظرات غیر مرتبط با این خبر منتشر نخواهد شد.
نام:
پست الکترونیک:
نظر:
*
 

عناوین اصلی